resource source identifier cell idtm intercalator ir Search Results


resource source identifier custom code zenodo  (ATCC)
99
ATCC resource source identifier custom code zenodo
Resource Source Identifier Custom Code Zenodo, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pm35385747-192-2-16?v=ATCC
Average 99 stars, based on 1 article reviews
resource source identifier custom code zenodo - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier
resource source identifier alt r crispr cas9 eed crrna  (Integrated DNA Technologies)
99
Integrated DNA Technologies resource source identifier alt r crispr cas9 eed crrna
Resource Source Identifier Alt R Crispr Cas9 Eed Crrna, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pm31786184-110-2-10?v=Integrated+DNA+Technologies
Average 99 stars, based on 1 article reviews
resource source identifier alt r crispr cas9 eed crrna - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier
pcr primer tufm_f  (Metabion International AG)
90
Metabion International AG pcr primer tufm_f
Pcr Primer Tufm F, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pmc08097689__mmc2-262-2-17?v=Metabion+International+AG
Average 90 stars, based on 1 article reviews
pcr primer tufm_f - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
hiv ltr luciferase reporter pjh325  (Promega)
90
Promega hiv ltr luciferase reporter pjh325
Hiv Ltr Luciferase Reporter Pjh325, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pm37402367-357-3-25?v=Promega
Average 90 stars, based on 1 article reviews
hiv ltr luciferase reporter pjh325 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
resource source identifier mhc ii fitc  (Thermo Fisher)
94
Thermo Fisher resource source identifier mhc ii fitc
Resource Source Identifier Mhc Ii Fitc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pm31053504-208-2-9?v=Thermo+Fisher
Average 94 stars, based on 1 article reviews
resource source identifier mhc ii fitc - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
resource source identifier gapdh reverse  (Addgene inc)
93
Addgene inc resource source identifier gapdh reverse
Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. <t>GAPDH</t> transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.
Resource Source Identifier Gapdh Reverse, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pm40157356-257-2-13?v=Addgene+inc
Average 93 stars, based on 1 article reviews
resource source identifier gapdh reverse - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
resource source identifier nuclease free duplex buffer integrated dna technologies  (Addgene inc)
90
Addgene inc resource source identifier nuclease free duplex buffer integrated dna technologies
Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. <t>GAPDH</t> transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.
Resource Source Identifier Nuclease Free Duplex Buffer Integrated Dna Technologies, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pm31216481-222-2-36?v=Addgene+inc
Average 90 stars, based on 1 article reviews
resource source identifier nuclease free duplex buffer integrated dna technologies - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
igf-1rzip  (GenScript corporation)
90
GenScript corporation igf-1rzip
Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. <t>GAPDH</t> transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.
Igf 1rzip, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pmc09364964__mmc2-190-2-16?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
igf-1rzip - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
gene exp actb mm00607939 s1  (Thermo Fisher)
99
Thermo Fisher gene exp actb mm00607939 s1
Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. <t>GAPDH</t> transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.
Gene Exp Actb Mm00607939 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pm33278339-212-69-67?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
gene exp actb mm00607939 s1 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier
recombinant dna pcmvr  (GenScript corporation)
90
GenScript corporation recombinant dna pcmvr
Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. <t>GAPDH</t> transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.
Recombinant Dna Pcmvr, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/pmc08221914__mmc2-237-2-32?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
recombinant dna pcmvr - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
reference identifiers additional information cell line hek293t atcc crl  (ATCC)
99
ATCC reference identifiers additional information cell line hek293t atcc crl
Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. <t>GAPDH</t> transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.
Reference Identifiers Additional Information Cell Line Hek293t Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/10__7554_slash_elife__51111-287-11-18?v=ATCC
Average 99 stars, based on 1 article reviews
reference identifiers additional information cell line hek293t atcc crl - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier
postscribed idtm  (Sony)
90
Sony postscribed idtm
Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. <t>GAPDH</t> transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.
Postscribed Idtm, supplied by Sony, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+cell+idtm+intercalator+ir/us09135948-193-5-8?v=Sony
Average 90 stars, based on 1 article reviews
postscribed idtm - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. GAPDH transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.

Journal: Neuron

Article Title: TDP-43 seeding induces cytoplasmic aggregation heterogeneity and nuclear loss of function of TDP-43.

doi: 10.1016/j.neuron.2025.03.004

Figure Lengend Snippet: Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. GAPDH transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER GAPDH Reverse: GAAGATGGTGATGGGATTTC IDT N/A Recombinant DNA pJ411_His-TDP43_LCD Addgene 98669 pLenti_CMV_TDP-43WT-Clover This paper N/A Software and algorithms FIJI (ImageJ) NIH https://imagej.net/software/fiji/downloads GraphPad prism GraphPad https://www.graphpad.com/ scientific-software/prism/ Harmony High-content imaging and analysis software PerkinElmer N/A NIS Elements Advanced Research software Nikon https://www.microscope.healthcare. nikon.com/products/software/niselements/nis-elements-advanced-research MATLAB MathWorks https://nl.mathworks.com/products/ matlab.html Zen Black 2.3 SP1 ZEISS https://www.micro-shop.zeiss.com/en/ us/softwarefinder/software-categories/ zen-black/zen-black-system/ Symphotime software PicoQuant https://www.picoquant.com/products/ category/software SnapGene Snapgene https://www.snapgene.com/ BioRender BioRender https://biorender.com/ Inkscape Inkscape https://inkscape.org/ Other 96-well imaging plate (PhenoPlate) PerkinElmer 6055802 Glass-bottom 8-well chamber slides Ibidi 80827 HisTrap HP column Cytiva 17524801 Superdex-200 16-600 size-exclusion column Cytiva 28989335 Äkta Pure protein purification system Cytiva N/A TEM copper grid Ted Pella Inc. 01753-F Microplate Shaker/Incubator PV-PVC Provocell N/A Branson 450 Digital Sonifier – Probe sonicator Branson N/A Bioruptor pico Diagenode N/A JEM 1400 elecron microscope JEOL N/A FluoStar Omega plate reader BMG Labtech N/A Operetta CLS microscope PerkinElmer N/A Nikon A1R Eclipse TiE confocal microscope Nikon N/A Zeiss LSM 880 confocal microscope Zeiss N/A

Techniques: Immunostaining, Reverse Transcription Polymerase Chain Reaction, RNA Sequencing, Control, Isolation, Labeling